News Column

Researchers Submit Patent Application, "Ddr2 Mutations as Targetable Features of Melanoma Or Basal Cell Carcinoma", for Approval

August 26, 2014



By a News Reporter-Staff News Editor at Life Science Weekly -- From Washington, D.C., NewsRx journalists report that a patent application by the inventors JONES, DANIEL M. (CHANTILLY, VA); WANG, YONGBAO (CHANTILLY, VA); BILLOUIN-FRAZIER, SHERE (CHANTILLY, VA); WINDHAM, JUSTIN (CHANTILLY, VA), filed on December 26, 2013, was made available online on August 14, 2014 (see also Quest Diagnostics Investments Incorporated).

The patent's assignee is Quest Diagnostics Investments Incorporated.

News editors obtained the following quote from the background information supplied by the inventors: "The following description is provided to assist the understanding of the reader. None of the information provided or references cited is admitted to be prior art to the present invention.

"Melanoma and Basal Cell Carcinoma

"Skin cancer is the most common of all cancers, afflicting more than one million Americans each year, a number that is rising rapidly. It is also the easiest to cure, if diagnosed and treated early. If allowed to progress to the point where it spreads to other sites, the prognosis is very poor. More than 8,000 melanoma deaths now occur per year.

"Melanoma is a malignant tumor of melanocytes. Melanocytes predominantly occur in skin, between the outer layer of the skin (the epidermis) and the next layer (the dermis), but are also found in other parts of the body, including the bowel and the eye (see uveal melanoma). Melanoma can occur in any part of the body that contains melanocytes or as a metastatic tumor of unknown primary lesion. Melanoma is less common than other skin cancers but is much more dangerous and causes the majority (75%) of deaths related to skin cancer.

"Melanoma arises from DNA damage to melanocytes. The early stage of the disease commonly begins with a radial growth phase when the tumor is confined to the epidermis followed by a dermal 'vertical growth phase' (VGP). Some melanomas attain further invasive potential, growing into the surrounding tissue and may spread around the body through blood or lymph vessels to form metastases.

"An immunological reaction against the tumor during the VGP may be judged by the presence and activity of the tumor infiltrating lymphocytes (TILs). These cells sometimes attack the primary tumor, and in certain cases, the primary tumor regresses with diagnosis of only the metastatic tumor.

"Multiple genetic events have been related to the pathogenesis (disease development) of melanoma. Some cases of melanoma have a clear genetic predisposition. Germline mutations in CDKN2A, CDK4, MC1R, MDM2 SNP309 and in genes associated with xeroderma pigmentosum (XP) predispose patients to developing melanoma. Other cases of familial melanoma are genetically heterogeneous, and putative loci for familial melanoma have been identified on the chromosome arms 1p, 9p and 12q.

"Clinical and Pathological Diagnosis

"Melanoma is usually first detected by visual examination of pigmented lesions of the skin, notably those that show: (A) asymmetry, (B) a border that is uneven, ragged, or notched, (C) coloring of different shades of brown, black, or tan and (D) diameter that has recently changed in size. In contrast, non-neoplastic moles or nevi are symmetrical, have a regular border, even coloration, and show no change in size/diameter over time. The main diagnostic concern is in distinguishing between a benign nevus, a dysplastic nevus-which may show progression over time, and a melanoma. Moles that are irregular in color or shape undergo further workup for melanoma. Following a visual examination and a dermatoscopic exam, or in vivo diagnostic tools such as a confocal microscope, a sample (biopsy) of the suspicious mole is usually obtained.

"Sample Preparation

"When an atypical mole has been identified, a skin biopsy takes place in order to best diagnose it. Local anesthetic is used to numb the area, then the mole is biopsied. The biopsy material is then sent to a laboratory to be evaluated by a pathologist. A skin biopsy can be a punch or shave biopsy, or complete excision. The complete excision is the preferred method, but a punch biopsy can suffice if the patient has cosmetic concerns (i.e. the patient does not want a scar) and the lesion is small. A scoop or deep shave biopsy is generally avoided due to risk of transecting a melanoma and thereby losing important prognostic information.

"Most dermatologists and dermatopathologists use a diagnostic schema for classifying melanocytic lesions based on how symmetrical the lesion is and the degree of cytologic atypia in the melanocytes. In this classification, a nevus is classified as unequivocally benign, atypical/dysplastic, or clearly melanoma. A benign nevus exhibits no significant cytologic atypia and symmetrical growth. An atypical mole is read as having either asymmetrical growth, and/or having (mild, moderate, or severe) cytologic atypia. Usually, cytologic atypia is of more important clinical concern than architectural atypia. Along with melanoma, nevi with moderate to severe cytologic atypia may require further excision to make sure that the surgical margin is completely clear of the lesion.

"Important aspects of the skin biopsy report for melanoma, including the pattern (presence/absence of an in situ component, radial or vertical growth), depth of invasion, presence of lymphocyte infiltrate, presence/absence of vascular or lymphatic invasion, presence/absence of a preexisting benign melanoma and the mitotic index. A further important aspect of the skin biopsy report for atypical nevi and melanoma is for the pathologist to indicate if the excision margin is clear of tumor. If there is any atypical melanocytes at the margin or if a melanoma is diagnosed, a reexcision is performed. Lymph node dissection may also be performed based on the tumor parameters seen on the initial biopsy and on the reexcision.

"Further molecular testing may be performed on melanoma biopsies, reexcision or lymph node metastatic samples to assess for targetable genetic changes to help select optimal therapy.

"BRAF

"BRAF is a human gene that makes a protein called B-Raf. The gene is also referred to as proto-oncogene B-Raf and v-Raf murine sarcoma viral oncogene homolog B1, while the protein is more formally known as serine/threonine-protein kinase B-Raf. B-Raf is a member of the Raf kinase family of serine/threonine-specific protein kinases. This protein plays a role in regulating the MAP kinase/ERK signaling pathway, which affects cell division, differentiation, and growth factor expression.

"In 2002, BRAF was shown to be mutated in human cancers. More than 30 mutations of the BRAF gene associated with human cancers have been identified. The frequency of BRAF mutations varies widely in human cancers from approximately 60% of melanomas and some types of benign nevi, to approximately 1-10% of common carcinomas such as lung adenocarcinoma (ACA) and colorectal cancer. In 90% of BRAF-mutated tumors, thymine is substituted for adenine at nucleotide 1799. This leads to valine (V) being substituted for by glutamate (E) at codon 600 (V600E) in the activation segment. This mutation has been widely observed in papillary thyroid carcinoma, colorectal cancer, melanoma and non-small-cell lung cancer. In June 2011, a team of Italian scientists used massively parallel sequencing to pinpoint mutation V600E as a likely driver mutation in 100% of cases of hairy cell leukemia. Less commonly, V600E mutation can also occur by a double nucleotide substitution.

"BRAF mutations which have been found are R462I, I463 S, G464E, G464V, G466A, G466E, G466V, G469A, G469E, N581S, E586K, D594V, F595L, G596R, L597V, T599I, V600D, V600E, V600K, V600R, K601E, E602K and A728V, etc. Most of these mutations are clustered in two regions of the gene: the glycine-rich P loop of the N lobe and the activation segment and flanking regions. Many of these mutations change the activation segment from an inactive state to an active state. For example in V600 mutations, the aliphatic side chain of Val600 interacts with the phenyl ring of Phe467 in the P loop. Replacing the medium-sized hydrophobic Val side chain with a larger and charged residue (such as the Val to Glu, Asp, Lys, or Arg changes seen in human tumors) can destabilize the interactions that maintain the DFG motif in an inactive conformation, resulting in conformational shift in the active position. Each BRAF kinase mutation has a variable effect on MEK phosphorylation activity, with most mutations having higher phosphorylation activity than the unmutated B-Raf protein, but some mutations show reduced or even absent kinase activity, termed 'inhibitory' BRAF mutations. The effect of these inhibitory mutations appears to be to activate wild-type C-Raf, which then signals to ERK.

"BRAF has also emerged as important drug target for tumor therapy. Drugs that treat cancers driven by BRAF mutations have been developed. On Aug. 17, 2011, one of them, vemurafenib, was approved by FDA for treatment of advanced-stage melanoma. Other BRAF-directed kinase inhibitors include GDC-0879, PLX-4720, sorafenib tosylate. dabrafenib, and LGX818.

"DDR2

"Discoidin domain receptor family, member 2, also known as DDR2 or CD 167b (cluster of differentiation 167b), is a receptor tyrosine kinase (RTK) that regulates cell growth, differentiation, and metabolism in response to extracellular signals. DDR2 mutation has been previously reported in 3-4% of squamous cell carcinoma (SCC) of the lung. In lung SCC, a few cases with DDR2 mutation were shown to have clinical response to treatment with the tyrosine kinase inhibitor dasatinib (Cancer Discov. 2011 April 3; 1(1): 78-89). The data suggested that DDR2 may be an important therapeutic target in SCC.

"DDR2 protein comprises an extracellular discoidin (DS) domain, a transmembrane domain and a kinase domain. The kinase domain is located at amino acids 563 to 849 of the full length protein (which includes the signal peptide) and the DS domain is located at amino acids 22-399. The nucleotide sequence of human DDR2 mRNA variant 2 is shown in GenBank Accession no. NM.sub.--006182."

As a supplement to the background information on this patent application, NewsRx correspondents also obtained the inventors' summary information for this patent application: "Methods of diagnosing melanoma in an individual are disclosed. In one aspect of the present invention, a method of diagnosing melanoma in an individual comprises (a) analyzing a biological sample from the individual, (b) detecting the presence of a nucleic acid encoding a DDR2 protein having a mutation selected from the group consisting of R105C, P321L, R458H, S467F, P476S, I488S, F574C, S667F, S674F, R680L, L701F, R742Q, and T836A in the sample, and diagnosing the individual as having melanoma when the mutation is detected, thereby indicating that the individual has melanoma.

"In another aspect, a method of diagnosing melanoma in an individual, comprises (a) analyzing a biological sample from the individual, (b) detecting the presence of a DDR2 protein having a mutation selected from the group consisting of R105C, P321L, R458H, S467F, P476S, I488S, F574C, S667F, S674F, R680L, L701F, R742Q, and T836A in the sample, and diagnosing the individual as having melanoma when the mutation is detected, thereby indicating that the individual has melanoma.

"In particular embodiments, the melanoma is advanced stage melanoma. The individual may have a skin lesion and/or may be suspected of having a skin disorder such as, for example, skin cancer, or melanoma.

"Methods of diagnosing basal cell carcinoma in an individual are also disclosed. In one aspect of the invention, a method of diagnosing basal cell carcinoma in an individual comprises (a) analyzing a biological sample from the individual, (b) detecting the presence of a nucleic acid encoding a DDR2 protein having a mutation selected from the group consisting of N146K, R399Q, and S702F in the sample, and diagnosing the individual as having basal cell carcinoma when the mutation is detected, thereby indicating that the individual has basal cell carcinoma.

"In another aspect of the invention, a method of diagnosing basal cell carcinoma in an individual, comprising (a) analyzing a biological sample from the individual, (b) detecting the presence of a DDR2 protein having a mutation selected from the group consisting N146K, R399Q, and S702F in the sample, and diagnosing the individual as having basal cell carcinoma when the mutation is detected, thereby indicating that the individual has basal cell carcinoma.

"The individual may have a skin lesion and/or may be suspected of having a skin disorder such as, for example, skin cancer, or basal cell carcinoma.

"Also disclosed are methods for determining likelihood that an individual with melanoma or basal cell carcinoma will respond to treatment with a kinase inhibitor, comprising (a) analyzing a biological sample from the individual, (b) detecting the presence of a DDR2 mutation that confers sensitivity to a kinase inhibitor in a DDR2 protein or nucleic acid in the sample, and identifying the individual as likely to respond to treatment with a kinase inhibitor when one or more of the DDR2 mutations is present, thereby indicating the individual is likely to respond to treatment with a kinase inhibitor.

"The DDR2 mutation may be a DDR2 protein mutation selected from the group consisting of R105C, P321L, R458H, S467F, P476S, I488S, F574C, S667F, S674F, R680L, L701F, R742Q, and T836A or a nucleic acid encoding a DDR2 protein having a mutation selected from the group consisting of R105C, P321L, R458H, S467F, P476S, I488S, F574C, S667F, S674F, R680L, L701F, R742Q, and T836A. The presence of any of these mutations may be in an individual with advanced stage melanoma.

"The method further may comprise detecting the presence of a BRAF mutation such as V600E or V600K in BRAF from the individual.

"In some embodiments, the DDR2 mutation is a DDR2 protein mutation selected from the group consisting of N146K, R399Q, and S702F; or a DDR2 nucleotide sequence encoding a DDR2 mutation selected from the group consisting of N146K, R399Q, and S702F. The presence of any of these mutations may be in an individual with basal cell carcinoma.

"In one embodiment, the step of analyzing a biological sample comprises sequencing the DDR2 gene for the presence of mutations known to confer sensitivity to DDR2 inhibitors. In some embodiments, the DDR2 nucleic acid sequence is examined for one or more mutations encoding N146K, R399Q, S702F, R105C, P321L, R458H, S467F, P476S, I488S, F574C, S667F, S674F, R680L, L701F, R742Q, or T836A in DDR2.

"Methods of identifying an individual having melanoma or basal cell carcinoma as a candidate for therapy with a DDR2 inhibitor are also disclosed. In some embodiments, a method of identifying an individual having melanoma or basal cell carcinoma as a candidate for therapy with a DDR2 inhibitor, comprises sequencing the DDR2 gene for the presence of mutations known to confer sensitivity to DDR2 kinase inhibitors. In some embodiments, the DDR2 sequence is examined for a sequence encoding at least one mutation selected from the group consisting of R105C, P321L, R458H, S467F, P476S, I488S, F574C, S667F, S674F, R680L, L701F, R742Q and T836A. In an alternate method, the candidate for therapy with a DDR2 inhibitor is identified by the expression levels of DDR2, wherein low expression levels of DDR2 such as GAPDH-normalized relative DDR2 transcript levels below 0.025 indicate the individual is a candidate for therapy.

"The invention comprises a method for treating melanoma or basal cell carcinoma in an individual comprising administering to the individual a therapeutically effective amount of a DDR2 inhibitor. In some embodiments, the melanoma is advanced stage melanoma. Suitable DDR2 inhibitors include kinase inhibitors, siRNA, shRNA, and an antibody that specifically binds to DDR2 or to a DDR2 having at least one mutation selected from the group consisting of R105C, P321L, R458H, S467F, P476S, I488S, F574C, S667F, S674F, R680L, L701F, R742Q, and T836A. In some embodiments, the DDR2 inhibitor is a tyrosine kinase inhibitor that inhibits kinase activity of DDR2. In some embodiments, the kinase inhibitor inhibits tyrosine kinase activity of DDR2 having at least one mutation in the kinase domain. In some embodiments, the kinase inhibitor inhibits tyrosine kinase activity of DDR2 having at least one mutation in the discoidin (DS) domain. In some embodiments, the tyrosine kinase inhibitor inhibits kinase activity of DDR2 having at least one mutation selected from the group consisting of R105C, P321L, R458H, S467F, P476S, I488S, F574C, S667F, S674F, R680L, L701F, R742Q, and T836A.

"Methods disclosed herein may be used to treat melanoma or basal cell carcinoma in an individual with a DDR2 mutation selected from the group consisting of a mutation in the DDR2 discoidin domain, a mutation in the DDR2 intracellular interacting domain, and a mutation in the DDR2 kinase domain. The DDR2 mutation may be a germline mutation or a somatic cell mutation. In some embodiments the DDR2 mutation is a N146K, R399Q, or S702F mutation. The DDR2 mutation may be encoded by a mutated DDR2 gene.

"In relation to therapy, the individual may be examined for mutations in DDR2 protein, comprising sequencing a DDR2 nucleic acid from the individual to determine if the nucleic acid encodes a DDR2 protein with a mutation, and subsequently the likelihood that the individual will respond to therapy with a DDR2 inhibitor. In particular embodiments, the DDR2 sequence of the individual may be determined before the start of treatment or during treatment.

"An individual with melanoma or basal cell carcinoma may harbor a mutation in a DDR2 nucleic acid sequence and/or a mutation in a BRAF nucleic acid sequence. The mutation may be in the individual's genomic DNA and/or in RNA. In some embodiments, the methods for treating melanoma or basal cell carcinoma disclosed herein are performed in an individual who does not harbor a mutation in a DDR2 or a BRAF nucleic acid or in an individual carrying a mutated DDR2 and/or BRAF gene or RNA.

"In another embodiment, an individual with melanoma or basal cell carcinoma is also treated with a BRAF inhibitor, such as an inhibitor that inhibits activity of BRAF with a mutation at codon 600 (such as a V600E or V600K mutation) or other sensitive BRAF mutations in addition to being treated with a DDR2 inhibitor. Suitable BRAF inhibitors include BRAF kinase inhibitors such as, for example, vemurafenib, GDC-0879, PLX-4720, sorafenib tosylate, dabrafenib, and LGX818.

"Compositions for treating melanoma and/or basal cell carcinoma also are provided. In one embodiment, a composition for the treatment of melanoma or basal cell carcinoma comprises a DDR2 inhibitor alone, or with a BRAF inhibitor. The DDR2 inhibitor may be a kinase inhibitor or one or more inhibitors selected from the group consisting of siRNA directed to a DDR2 nucleic acid, shRNA directed to a DDR2 nucleic acid, and an antibody that specifically binds to a DDR2 polypeptide and inhibits DDR2 kinase activity. In some embodiments, the DDR2 kinase inhibitor inhibits DDR2 having mutations in the kinase domain. In some embodiments, the inhibitor inhibits DDR2 having mutations in the discoidin domain. In some embodiments, the composition comprises a DDR2 kinase inhibitor that inhibits kinase activity of DDR2 having one or more of R105C, P321L, R458H, S467F, P476S, I488S, F574C, S667F, S674F, R680L, L701F, R742Q and T836A mutations. The BRAF inhibitor may be, for example, a kinase inhibitor such as vemurafenib, GDC-0879, PLX-4720, sorafenib tosylate, dabrafenib, and LGX818.

"The invention also includes kits. For example, a kit for identifying the presence of DDR2 and/or BRAF mutations, the kit comprising at least one primer selected from

"TABLE-US-00001 Exon3F TCCAGTTCCAACACCATCTTC Exon 4F TTTCTCTTTGGTTTCTCTTGGTC Exon 5-1F CCCAACCCTCACCTCTCAAG Exon 5-2F CCAGTGGAACCTGATGACCT Exon 5-3F CCATGCAGGAGGTCATGG Exon 6-1F CACTCATTCTCTTCTCTCTCCTCA Exon6-2F CCATTGTAGCCAGATTTGTCC Exon 7F CTTGGCTGTGTTTCCTTTGC exon 8-1F CTCTTCTCCTGGCCTGAGC Exon 8-2F CCCAGACCCATGAATACCAC Exon 9-1F TCACATGCCTCTTTCTCTACCA Exon 9-2F CAGTGCTACTTCCGCTCTGA Exon 9-3F CCCAGTGCTCGGTTTGTC Exon 10F GCTCTGACTCACCCTTGTTTT Exon 11-1F CCTTCTCTCCCTGGTCACAG Exon 11-2F GGATCCTGATTGGCTGCTT Exon 12-1F TCTCCTTGCTCTTCTCTTCCA Exon 12-2F ACCGCTCCTCATCACCTAGT exon 13-1F CTCGTTGCCCTTGTCTTCC Exon 13-2F GAGGGGGTGCCCCACTAT Exon 13-3F AGTGCCTGCCGTCACCAT exon 14-1F TGATGCTGAGACTAGATGACTTTTG Exon 14-2F GGGAATGGAAAAATTCAAAGA exon 15-1F TTTATCTATGTCTGTATCCTCCCAAG Exon 15-2F CCATCTATTAGCTGTGTGTATCACTG Exon 16-1F CCTTCTGTCTTCTTGTCTATTTCCTC Exon 16-2F2 TCTCTTAATTTTGTTCACCGAGA Exon 16-3F2 CTTTGAATGAGCAGGAACC Exon 17-1F TGATTTCCCATTCTTTTCTTTACTT Exon 17-2F TTTGTGGGAGACTTTCACCTTT Exon 18-1F TTTCCTTTATTTTTGTTCCCAAAG Exon 18-2F GCTGCTGGAGAAGAGATACGA BRAF11-1F TCTGTTTGGCTTGACTTGACTT BRAF11-2F GACGGGACTCGAGTGATGAT Exon 12-1R GCGATCGTAAGTCGAGTTGG Exon 12-2R CCCACCACATCATCCTCAC exon 13-1R TGTGTTGCCTCCTGTCACTC Exon 13-2R TGGGGAACTCCTCCACAG Exon 13-3R AAGGGAATCAAAGAATCAACTCA exon 14-1R GCTCGGAGCATTTTCACA Exon14-2R GGAAAATTCAAAATGTAGACCACAG exon 15-1R CATGTATTCAGTGATCATACAGAGAGG Exon 15-2R AGAAGGAAGACCTGGCTTGTT Exon 16-1R TGTGTAGTTCTTACCCACTAAACAGT Exon 16-2R2 GCCCTGGATCCGGTAATAGT Exon 16-3R2 CAGGGCTTTAAAATGCTGAGA Exon 17-1R TCTGACAGCTGGGAATAGGG Exon 17-2R CCATTCATCCCCAACAGTTC Exon 18-1R GCAGAAGGTGGATTTCTTGG Exon 18-2R AGGACCTGAGCCGTAGGAAC BRAF11-1R TCCAATTCTTTGTCCCACTG BRAF11-2R TGTCACAATGTCACCACATTACA BRAF15-1R GACCCACTCCATCGAGATTT and BRAF15-2R TCAGTGGAAAAATAGCCTCAA

BRIEF DESCRIPTION OF THE DRAWINGS

"FIG. 1 is a sequence alignment of the DDR2 protein (top lines) compared with DDR1 (bottom) showing conserved sequence between the two proteins at the sites of DDR2 mutations seen in extracellular-DS domains (amino acids 22-399) and the kinase domain (amino acids 563 to 849) including F574C, S667F, R680L, L701F, R742Q and T836A.

"FIG. 2 shows a sequence alignment of three mutations in the DDR2 kinase domain, F574C, S667F and L701F, identified by Ion Torrent sequencing of genomic DNA extracted from macrodissected formalin-fixed paraffin-embedded (FFPE) sections of melanomas; middle panels show mutation confirmations by bidirectional Sanger sequencing; bottom panels show alignment of the mutations in the DDR2 kinase domain with the homologous locations in other kinases, including BRAF, EGFR and ALK.

"FIG. 3 shows DDR2 expressed at low levels in DDR2-mutated melanoma.

"FIG. 4 shows an S702F kinase domain mutation in basal cell carcinoma.

"FIG. 5 shows N146K and R399Q biallelic DDR2 mutations in basal cell carcinoma."

For additional information on this patent application, see: JONES, DANIEL M.; WANG, YONGBAO; BILLOUIN-FRAZIER, SHERE; WINDHAM, JUSTIN. Ddr2 Mutations as Targetable Features of Melanoma Or Basal Cell Carcinoma. Filed December 26, 2013 and posted August 14, 2014. Patent URL: http://appft.uspto.gov/netacgi/nph-Parser?Sect1=PTO2&Sect2=HITOFF&u=%2Fnetahtml%2FPTO%2Fsearch-adv.html&r=3594&p=72&f=G&l=50&d=PG01&S1=20140807.PD.&OS=PD/20140807&RS=PD/20140807

Keywords for this news article include: Kinase, Therapy, Peptides, Proteins, Tyrosine, Legal Issues, Aromatic Amino Acids, Enzymes and Coenzymes, Quest Diagnostics Investments Incorporated.

Our reports deliver fact-based news of research and discoveries from around the world. Copyright 2014, NewsRx LLC


For more stories on investments and markets, please see HispanicBusiness' Finance Channel



Source: Life Science Weekly


Story Tools






HispanicBusiness.com Facebook Linkedin Twitter RSS Feed Email Alerts & Newsletters